sept9 assay Search Results


92
Atlas Antibodies anti sept9
Anti Sept9, supplied by Atlas Antibodies, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti sept9/product/Atlas Antibodies
Average 92 stars, based on 1 article reviews
anti sept9 - by Bioz Stars, 2026-05
92/100 stars
  Buy from Supplier

92
Addgene inc plasmids pegfp c2 sept9 i1
Plasmids Pegfp C2 Sept9 I1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmids pegfp c2 sept9 i1/product/Addgene inc
Average 92 stars, based on 1 article reviews
plasmids pegfp c2 sept9 i1 - by Bioz Stars, 2026-05
92/100 stars
  Buy from Supplier

92
Proteintech polyclonal rabbit anti human septin 9 10769 1 ap
Polyclonal Rabbit Anti Human Septin 9 10769 1 Ap, supplied by Proteintech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/polyclonal rabbit anti human septin 9 10769 1 ap/product/Proteintech
Average 92 stars, based on 1 article reviews
polyclonal rabbit anti human septin 9 10769 1 ap - by Bioz Stars, 2026-05
92/100 stars
  Buy from Supplier

89
Thermo Fisher gene exp sept9 hs00246396 m1
Gene Exp Sept9 Hs00246396 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp sept9 hs00246396 m1/product/Thermo Fisher
Average 89 stars, based on 1 article reviews
gene exp sept9 hs00246396 m1 - by Bioz Stars, 2026-05
89/100 stars
  Buy from Supplier

90
Thermo Fisher gene exp sept9 mm01248788 m1
Gene Exp Sept9 Mm01248788 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp sept9 mm01248788 m1/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
gene exp sept9 mm01248788 m1 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

93
OriGene human sept9 gfp plasmid
Single-cell RNA sequencing analysis of normal ileal and colonic tissues showing (A) <t>SEPT9</t> expression in different types of intestinal cells and (B) its distribution in different IEC subtypes. (C) Immunofluorescence labeling of whole mount mouse small intestinal tissues with an anti-SEPT9 antibody (magenta) and F-actin probe phalloidin (green). Scale bar= 20 μm. (D and E) Localization of endogenous SEPT9 in the ileum and colon of SEPT9-mNG mice. Scale bars= 50 μm in upper and 10 μm in lower images. (F) Colocalization of endogenous SEPT9-NeonGreen with immunostained TJ (ZO-1) and AJ (β-catenin) markers in wholemount mouse ileal mucosa. Scale bar= 5 μm. (G) Fluorescent intensity plots of SEPT9 (cyan), ZO-1 (yellow) and β-catenin (magenta) at different Z-planes at the IEC apical junctions. (H) A schematic representation of SEPT9 localization at apical junctions in IEC.
Human Sept9 Gfp Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human sept9 gfp plasmid/product/OriGene
Average 93 stars, based on 1 article reviews
human sept9 gfp plasmid - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

86
Proteintech septin 9 sept9
Differential peripheral myelin proteome analysis in the Prnp0/0model of chronic demyelinating polyneuropathy. A, 2D-DIGE of wild-type (WT, false-colored in blue) and Prnp0/0 (false colored in orange) myelin. 2D-IEF/SDS-PAGE was performed with IEF in a nonlinear pH gradient (3–11) as the first and SDS-PAGE as the second dimension. Most protein signals appear as black spots, indicating that the overall protein profile is largely similar between the genotypes. One spot at ∼40 kDa was of increased abundance in Prnp0/0 myelin and identified as <t>SEPT9.</t> The corresponding region of a representative gel (red frame) is shown to the right with separated detection channels. Note that the abundance of SEPT9 in wild-type myelin was below the threshold of MS detection. Note also the high comparability with the reference map in Figure 2A. B, Comparison of SEPT9 abundance in myelin of WT and Prnp0/0 myelin by immunoblotting. Note that the abundance of the related SEPT7 was unchanged. Quantification of SEPT9 abundance was relative to that of GAPDH. C, Immunoblot analysis of SEPT9 in brain lysates and myelin-enriched fractions. Note that the abundance of SEPT9 was reduced with myelin purification, different from known constituents of the compact subcompartment of myelin. D, In situ hybridization of Sept9 in sciatic nerves. Note that Schwann cells are strongly labeled. Scale bar, 6 μm. E, Quantitative RT-PCR analysis of Sept9 in adult wild-type and Prnp0/0 sciatic nerves. Sept9-mRNA abundance was unaltered. F, Immunodetection of SEPT9 visualized with 10 nm gold particles in wild-type sciatic nerve cross sections. SEPT9 labeling was confined to the abaxonal noncompact subcompartment of myelin (bands of Cajal). The magnification shows that SEPT9 was associated with membranous structures, most likely intracellular transport vesicles (F′, arrowheads). G, No labeling was found in wild-type Schmidt–Lanterman incisures. H, SEPT9 was readily detected in Schmidt–Lanterman incisures of Prnp0/0 myelin (arrowheads). Scale bars: F, 500 nm; and G, H, 200 nm.
Septin 9 Sept9, supplied by Proteintech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/septin 9 sept9/product/Proteintech
Average 86 stars, based on 1 article reviews
septin 9 sept9 - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

92
Addgene inc plasmid mcherry sept9 i1
Differential peripheral myelin proteome analysis in the Prnp0/0model of chronic demyelinating polyneuropathy. A, 2D-DIGE of wild-type (WT, false-colored in blue) and Prnp0/0 (false colored in orange) myelin. 2D-IEF/SDS-PAGE was performed with IEF in a nonlinear pH gradient (3–11) as the first and SDS-PAGE as the second dimension. Most protein signals appear as black spots, indicating that the overall protein profile is largely similar between the genotypes. One spot at ∼40 kDa was of increased abundance in Prnp0/0 myelin and identified as <t>SEPT9.</t> The corresponding region of a representative gel (red frame) is shown to the right with separated detection channels. Note that the abundance of SEPT9 in wild-type myelin was below the threshold of MS detection. Note also the high comparability with the reference map in Figure 2A. B, Comparison of SEPT9 abundance in myelin of WT and Prnp0/0 myelin by immunoblotting. Note that the abundance of the related SEPT7 was unchanged. Quantification of SEPT9 abundance was relative to that of GAPDH. C, Immunoblot analysis of SEPT9 in brain lysates and myelin-enriched fractions. Note that the abundance of SEPT9 was reduced with myelin purification, different from known constituents of the compact subcompartment of myelin. D, In situ hybridization of Sept9 in sciatic nerves. Note that Schwann cells are strongly labeled. Scale bar, 6 μm. E, Quantitative RT-PCR analysis of Sept9 in adult wild-type and Prnp0/0 sciatic nerves. Sept9-mRNA abundance was unaltered. F, Immunodetection of SEPT9 visualized with 10 nm gold particles in wild-type sciatic nerve cross sections. SEPT9 labeling was confined to the abaxonal noncompact subcompartment of myelin (bands of Cajal). The magnification shows that SEPT9 was associated with membranous structures, most likely intracellular transport vesicles (F′, arrowheads). G, No labeling was found in wild-type Schmidt–Lanterman incisures. H, SEPT9 was readily detected in Schmidt–Lanterman incisures of Prnp0/0 myelin (arrowheads). Scale bars: F, 500 nm; and G, H, 200 nm.
Plasmid Mcherry Sept9 I1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmid mcherry sept9 i1/product/Addgene inc
Average 92 stars, based on 1 article reviews
plasmid mcherry sept9 i1 - by Bioz Stars, 2026-05
92/100 stars
  Buy from Supplier

89
Thermo Fisher gene exp sept9 rn00582942 m1
Glucose-sensitive clonal INS-1 832/13 β-cells were used to study the impact of Cdkn1a, Pde7b, <t>Sept9</t> and Exoc3l on insulin secretion and β-cell function. ( A ) Overexpression of Cdkn1a , Pde7b and Sept9 with pcDNA3.1 expression vectors in clonal β-cells resulted in elevated mRNA levels (black bars) compared with β-cells transfected with an empty pcDNA3.1 vector (white bars). * P <0.05. Data are mean ± SEM. Overexpression was also evident at the protein level as determined by immunoblot detection of the HA-tag situated on the c-terminal of the cloned cDNAs (rightmost panel) ( B ) Insulin secretion in response to 2.8 mM (white bars) and 16.7 mM (black bars) glucose in clonal β-cells overexpressing either Cdkn1a, Pde7b or Sept9 compared with control cells transfected with an empty pcDNA3.1 vector (n = 5). * P <0.05. Data are mean ± SEM ( C ) Decreased cell proliferation in clonal β-cells overexpressing Cdkn1a (black bar) compared with cells transfected with an empty pcDNA3.1 vector (white bar) (n = 4). * P <0.05. Data are mean ± SEM ( D ) Insulin secretion in response to 2.8 mM and 16.7 mM glucose (Gluc) or 16.7 mM glucose (Gluc) in combination with 100 µM IBMX in clonal β-cells overexpressing Pde7b (black bars) compared with cells transfected with an empty pcDNA3.1 vector (white bars) (n = 3). * P <0.05. NS = not significant. ( E ) Increased DNA methylation and decreased mRNA expression of EXOC3L2 in pancreatic islets of 15 T2D versus 34 non-diabetic donors. ( F ) Transfection of clonal β-cells with siRNA targeting Exoc3l resulted in decreased Exoc3l mRNA expression (siExo3l, black bar) when compared with clonal β-cells transfected with negative control siRNA (siNC, white bar) (n = 3). * P <0.05. Silencing of Exoc3l resulted in decreased Ca 2+ -dependent exocytosis; ( G ) Depolarizationevoked a decrease in membrane capacitance (ΔC m ) in single INS1-832/13 β-cells where Exoc3l was silenced (black trace) compared with control β-cells (grey trace) treated with negative control siRNA. ( H ) Histogram of the summed increase in membrane capacitance evoked by the two first depolarizations (Σ 1–2 ), the latter eight depolarizations (Σ 3–10 ) or all depolarizations in the train (Σ all ). Data are mean ± SEM of n = 11 β-cells treated with control siRNA (white bars) and n = 4 β-cells treated with siRNA against Exoc3l (black bars). * P <0.05. ( I ) Depolarization-evoked increase in current (I) in single INS1-832/13 β-cells treated with control siRNA (grey trace) or siRNA targeting Exoc3l (black trace). Notice that the rapid Na + -current is markedly diminished in siExoc3l treated clonal β-cells. ( J ) Reduced expression of Exoc3l has no effect on the Ca 2+ influx. Charge (Q)-voltage (V m ) relationship in β-cells treated with control (white squares) siRNA and siRNA against Exoc3l (black circles). The charge is representative of the Ca 2+ -influx into the cell through the voltage-dependent Ca 2+ channels. ( K ) As in J , but the peak-current (Ipeak)-voltage (Vm)-relationship was estimated as a representation of the voltage-dependent Na + current. The Na + current is significantly reduced in siExoc3l cells ( P <0.05) versus control siRNA cells except for the depolarization to −40 mV. Data in J and K are mean ± SEM of n = 11 β-cells treated with control siRNA and n = 7 siExoc3l treated β-cells. ( L ) αTC1-6 cells were used to determine the impact of Cdkn1a, Pde7b and Sept9 on glucagon secretion. Overexpression of Cdkn1a and Pde7b resulted in significantly increased glucagon secretion at 1 mM glucose (white bars) (n = 4, * P <0.05), while overexpression of Pde7b and Sept9 resulted in increased glucagon secretion at 16.7 mM glucose (black bars) (n = 4, ¤ P <0.05) compared with control cells transfected with an empty pcDNA3.1 vector.
Gene Exp Sept9 Rn00582942 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp sept9 rn00582942 m1/product/Thermo Fisher
Average 89 stars, based on 1 article reviews
gene exp sept9 rn00582942 m1 - by Bioz Stars, 2026-05
89/100 stars
  Buy from Supplier

90
OriGene sequence verified sept9 transcript variant 1
Glucose-sensitive clonal INS-1 832/13 β-cells were used to study the impact of Cdkn1a, Pde7b, <t>Sept9</t> and Exoc3l on insulin secretion and β-cell function. ( A ) Overexpression of Cdkn1a , Pde7b and Sept9 with pcDNA3.1 expression vectors in clonal β-cells resulted in elevated mRNA levels (black bars) compared with β-cells transfected with an empty pcDNA3.1 vector (white bars). * P <0.05. Data are mean ± SEM. Overexpression was also evident at the protein level as determined by immunoblot detection of the HA-tag situated on the c-terminal of the cloned cDNAs (rightmost panel) ( B ) Insulin secretion in response to 2.8 mM (white bars) and 16.7 mM (black bars) glucose in clonal β-cells overexpressing either Cdkn1a, Pde7b or Sept9 compared with control cells transfected with an empty pcDNA3.1 vector (n = 5). * P <0.05. Data are mean ± SEM ( C ) Decreased cell proliferation in clonal β-cells overexpressing Cdkn1a (black bar) compared with cells transfected with an empty pcDNA3.1 vector (white bar) (n = 4). * P <0.05. Data are mean ± SEM ( D ) Insulin secretion in response to 2.8 mM and 16.7 mM glucose (Gluc) or 16.7 mM glucose (Gluc) in combination with 100 µM IBMX in clonal β-cells overexpressing Pde7b (black bars) compared with cells transfected with an empty pcDNA3.1 vector (white bars) (n = 3). * P <0.05. NS = not significant. ( E ) Increased DNA methylation and decreased mRNA expression of EXOC3L2 in pancreatic islets of 15 T2D versus 34 non-diabetic donors. ( F ) Transfection of clonal β-cells with siRNA targeting Exoc3l resulted in decreased Exoc3l mRNA expression (siExo3l, black bar) when compared with clonal β-cells transfected with negative control siRNA (siNC, white bar) (n = 3). * P <0.05. Silencing of Exoc3l resulted in decreased Ca 2+ -dependent exocytosis; ( G ) Depolarizationevoked a decrease in membrane capacitance (ΔC m ) in single INS1-832/13 β-cells where Exoc3l was silenced (black trace) compared with control β-cells (grey trace) treated with negative control siRNA. ( H ) Histogram of the summed increase in membrane capacitance evoked by the two first depolarizations (Σ 1–2 ), the latter eight depolarizations (Σ 3–10 ) or all depolarizations in the train (Σ all ). Data are mean ± SEM of n = 11 β-cells treated with control siRNA (white bars) and n = 4 β-cells treated with siRNA against Exoc3l (black bars). * P <0.05. ( I ) Depolarization-evoked increase in current (I) in single INS1-832/13 β-cells treated with control siRNA (grey trace) or siRNA targeting Exoc3l (black trace). Notice that the rapid Na + -current is markedly diminished in siExoc3l treated clonal β-cells. ( J ) Reduced expression of Exoc3l has no effect on the Ca 2+ influx. Charge (Q)-voltage (V m ) relationship in β-cells treated with control (white squares) siRNA and siRNA against Exoc3l (black circles). The charge is representative of the Ca 2+ -influx into the cell through the voltage-dependent Ca 2+ channels. ( K ) As in J , but the peak-current (Ipeak)-voltage (Vm)-relationship was estimated as a representation of the voltage-dependent Na + current. The Na + current is significantly reduced in siExoc3l cells ( P <0.05) versus control siRNA cells except for the depolarization to −40 mV. Data in J and K are mean ± SEM of n = 11 β-cells treated with control siRNA and n = 7 siExoc3l treated β-cells. ( L ) αTC1-6 cells were used to determine the impact of Cdkn1a, Pde7b and Sept9 on glucagon secretion. Overexpression of Cdkn1a and Pde7b resulted in significantly increased glucagon secretion at 1 mM glucose (white bars) (n = 4, * P <0.05), while overexpression of Pde7b and Sept9 resulted in increased glucagon secretion at 16.7 mM glucose (black bars) (n = 4, ¤ P <0.05) compared with control cells transfected with an empty pcDNA3.1 vector.
Sequence Verified Sept9 Transcript Variant 1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sequence verified sept9 transcript variant 1/product/OriGene
Average 90 stars, based on 1 article reviews
sequence verified sept9 transcript variant 1 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

86
Thermo Fisher gene exp sept9 hs01107941 m1
Glucose-sensitive clonal INS-1 832/13 β-cells were used to study the impact of Cdkn1a, Pde7b, <t>Sept9</t> and Exoc3l on insulin secretion and β-cell function. ( A ) Overexpression of Cdkn1a , Pde7b and Sept9 with pcDNA3.1 expression vectors in clonal β-cells resulted in elevated mRNA levels (black bars) compared with β-cells transfected with an empty pcDNA3.1 vector (white bars). * P <0.05. Data are mean ± SEM. Overexpression was also evident at the protein level as determined by immunoblot detection of the HA-tag situated on the c-terminal of the cloned cDNAs (rightmost panel) ( B ) Insulin secretion in response to 2.8 mM (white bars) and 16.7 mM (black bars) glucose in clonal β-cells overexpressing either Cdkn1a, Pde7b or Sept9 compared with control cells transfected with an empty pcDNA3.1 vector (n = 5). * P <0.05. Data are mean ± SEM ( C ) Decreased cell proliferation in clonal β-cells overexpressing Cdkn1a (black bar) compared with cells transfected with an empty pcDNA3.1 vector (white bar) (n = 4). * P <0.05. Data are mean ± SEM ( D ) Insulin secretion in response to 2.8 mM and 16.7 mM glucose (Gluc) or 16.7 mM glucose (Gluc) in combination with 100 µM IBMX in clonal β-cells overexpressing Pde7b (black bars) compared with cells transfected with an empty pcDNA3.1 vector (white bars) (n = 3). * P <0.05. NS = not significant. ( E ) Increased DNA methylation and decreased mRNA expression of EXOC3L2 in pancreatic islets of 15 T2D versus 34 non-diabetic donors. ( F ) Transfection of clonal β-cells with siRNA targeting Exoc3l resulted in decreased Exoc3l mRNA expression (siExo3l, black bar) when compared with clonal β-cells transfected with negative control siRNA (siNC, white bar) (n = 3). * P <0.05. Silencing of Exoc3l resulted in decreased Ca 2+ -dependent exocytosis; ( G ) Depolarizationevoked a decrease in membrane capacitance (ΔC m ) in single INS1-832/13 β-cells where Exoc3l was silenced (black trace) compared with control β-cells (grey trace) treated with negative control siRNA. ( H ) Histogram of the summed increase in membrane capacitance evoked by the two first depolarizations (Σ 1–2 ), the latter eight depolarizations (Σ 3–10 ) or all depolarizations in the train (Σ all ). Data are mean ± SEM of n = 11 β-cells treated with control siRNA (white bars) and n = 4 β-cells treated with siRNA against Exoc3l (black bars). * P <0.05. ( I ) Depolarization-evoked increase in current (I) in single INS1-832/13 β-cells treated with control siRNA (grey trace) or siRNA targeting Exoc3l (black trace). Notice that the rapid Na + -current is markedly diminished in siExoc3l treated clonal β-cells. ( J ) Reduced expression of Exoc3l has no effect on the Ca 2+ influx. Charge (Q)-voltage (V m ) relationship in β-cells treated with control (white squares) siRNA and siRNA against Exoc3l (black circles). The charge is representative of the Ca 2+ -influx into the cell through the voltage-dependent Ca 2+ channels. ( K ) As in J , but the peak-current (Ipeak)-voltage (Vm)-relationship was estimated as a representation of the voltage-dependent Na + current. The Na + current is significantly reduced in siExoc3l cells ( P <0.05) versus control siRNA cells except for the depolarization to −40 mV. Data in J and K are mean ± SEM of n = 11 β-cells treated with control siRNA and n = 7 siExoc3l treated β-cells. ( L ) αTC1-6 cells were used to determine the impact of Cdkn1a, Pde7b and Sept9 on glucagon secretion. Overexpression of Cdkn1a and Pde7b resulted in significantly increased glucagon secretion at 1 mM glucose (white bars) (n = 4, * P <0.05), while overexpression of Pde7b and Sept9 resulted in increased glucagon secretion at 16.7 mM glucose (black bars) (n = 4, ¤ P <0.05) compared with control cells transfected with an empty pcDNA3.1 vector.
Gene Exp Sept9 Hs01107941 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp sept9 hs01107941 m1/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
gene exp sept9 hs01107941 m1 - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

90
Epigenomics ag dna methylation biomarkers sept9 and shox2
DNA methylation of <t>SHOX2</t> and SEPT9 in ascitic samples from cancer and non-cancer patients. Comparison of SHOX2 and SEPT9 methylation of ascitic DNA from cancer patients and patients with exclusively non-malignant diseases determined by quantitative real-time PCR. Methylation cutoffs were introduced for SHOX2 and SEPT9 to dichotomize patient samples as SHOX2 or SEPT9 positive (above the cutoff) or negative (below the cutoff), respectively. The indicated p values refer to the Mann-Whitney U tests. a DNA methylation analysis of the cellular fractions of ascites samples ( n = 283). b Methylation results of cell-free ascitic DNA ( n = 162)
Dna Methylation Biomarkers Sept9 And Shox2, supplied by Epigenomics ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna methylation biomarkers sept9 and shox2/product/Epigenomics ag
Average 90 stars, based on 1 article reviews
dna methylation biomarkers sept9 and shox2 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

Image Search Results


Single-cell RNA sequencing analysis of normal ileal and colonic tissues showing (A) SEPT9 expression in different types of intestinal cells and (B) its distribution in different IEC subtypes. (C) Immunofluorescence labeling of whole mount mouse small intestinal tissues with an anti-SEPT9 antibody (magenta) and F-actin probe phalloidin (green). Scale bar= 20 μm. (D and E) Localization of endogenous SEPT9 in the ileum and colon of SEPT9-mNG mice. Scale bars= 50 μm in upper and 10 μm in lower images. (F) Colocalization of endogenous SEPT9-NeonGreen with immunostained TJ (ZO-1) and AJ (β-catenin) markers in wholemount mouse ileal mucosa. Scale bar= 5 μm. (G) Fluorescent intensity plots of SEPT9 (cyan), ZO-1 (yellow) and β-catenin (magenta) at different Z-planes at the IEC apical junctions. (H) A schematic representation of SEPT9 localization at apical junctions in IEC.

Journal: bioRxiv

Article Title: The Septin Cytoskeleton is a Novel Regulator of Intestinal Epithelial Barrier Integrity and Mucosal Inflammation

doi: 10.1101/2024.12.20.629767

Figure Lengend Snippet: Single-cell RNA sequencing analysis of normal ileal and colonic tissues showing (A) SEPT9 expression in different types of intestinal cells and (B) its distribution in different IEC subtypes. (C) Immunofluorescence labeling of whole mount mouse small intestinal tissues with an anti-SEPT9 antibody (magenta) and F-actin probe phalloidin (green). Scale bar= 20 μm. (D and E) Localization of endogenous SEPT9 in the ileum and colon of SEPT9-mNG mice. Scale bars= 50 μm in upper and 10 μm in lower images. (F) Colocalization of endogenous SEPT9-NeonGreen with immunostained TJ (ZO-1) and AJ (β-catenin) markers in wholemount mouse ileal mucosa. Scale bar= 5 μm. (G) Fluorescent intensity plots of SEPT9 (cyan), ZO-1 (yellow) and β-catenin (magenta) at different Z-planes at the IEC apical junctions. (H) A schematic representation of SEPT9 localization at apical junctions in IEC.

Article Snippet: DLD-1 cells were grown to sub-confluency and transfected with human SEPT9-GFP plasmid (OriGene, Rockville, MD; RG225682).

Techniques: RNA Sequencing Assay, Expressing, Immunofluorescence, Labeling

The plots show correlation of SEPT9 transcript with the levels of SEPT2, SEPT7 and SEPT11transcripts in epithelial cell subpopulation in normal human ileum (A) and normal human colon (B) . Numbers of the top of the graphs are Pearson correlation between two genes. Cell cluster abbreviations are: DeepCrypt, deep crypt secretor; EC, enterocytes; EEC, enteroendocrine; GC, Goblet; SC, stem; TA, transit amplifying; Tuft, tuft cells.

Journal: bioRxiv

Article Title: The Septin Cytoskeleton is a Novel Regulator of Intestinal Epithelial Barrier Integrity and Mucosal Inflammation

doi: 10.1101/2024.12.20.629767

Figure Lengend Snippet: The plots show correlation of SEPT9 transcript with the levels of SEPT2, SEPT7 and SEPT11transcripts in epithelial cell subpopulation in normal human ileum (A) and normal human colon (B) . Numbers of the top of the graphs are Pearson correlation between two genes. Cell cluster abbreviations are: DeepCrypt, deep crypt secretor; EC, enterocytes; EEC, enteroendocrine; GC, Goblet; SC, stem; TA, transit amplifying; Tuft, tuft cells.

Article Snippet: DLD-1 cells were grown to sub-confluency and transfected with human SEPT9-GFP plasmid (OriGene, Rockville, MD; RG225682).

Techniques:

Validation of SEPT9 loss in SEPT9-KO mice. Representative immunoblots (A) and densitometric quantification (B) of SEPT9 expression in colonic scrapes, and immunolabeling for SEPT9 in ileal epithelia (C). Mean ± SEM, n= 4; *p<0.05. Scale bar= 10μm. (D and E) Gut-to-blood passage of 4 kDa FITC-dextran and 70 kDa Rhodamine-dextran in SEPT9-KO and control mice. Mean ± SEM, n= 6; ****p<0.0001. Representative en face images and quantification of immunolabeled junctional markers in wholemount colon of SEPT9-KO and control mice, including claudin3 (F and G), ZO-1 (H and I), β-catenin (J and K) and E-cadherin (L and M). Scale bars= 10 μm. White dash boxes indicate the zoomed areas. Arrowheads highlight accumulation of cytoplasmic TJ and AJ proteins in SEPT9-KO mice. (N-P) Measurements of junctional morphology in colonic mucosa of SEPT9-KO and control mice examined via measuring circularity (N), solidity (O), and the cell surface area (P); n= 5/group. Data represented as box-whisker plots with whiskers extending to the minimum and the maximum and mean at the middle of the box body. **p<0.01, ****p<0.0001.

Journal: bioRxiv

Article Title: The Septin Cytoskeleton is a Novel Regulator of Intestinal Epithelial Barrier Integrity and Mucosal Inflammation

doi: 10.1101/2024.12.20.629767

Figure Lengend Snippet: Validation of SEPT9 loss in SEPT9-KO mice. Representative immunoblots (A) and densitometric quantification (B) of SEPT9 expression in colonic scrapes, and immunolabeling for SEPT9 in ileal epithelia (C). Mean ± SEM, n= 4; *p<0.05. Scale bar= 10μm. (D and E) Gut-to-blood passage of 4 kDa FITC-dextran and 70 kDa Rhodamine-dextran in SEPT9-KO and control mice. Mean ± SEM, n= 6; ****p<0.0001. Representative en face images and quantification of immunolabeled junctional markers in wholemount colon of SEPT9-KO and control mice, including claudin3 (F and G), ZO-1 (H and I), β-catenin (J and K) and E-cadherin (L and M). Scale bars= 10 μm. White dash boxes indicate the zoomed areas. Arrowheads highlight accumulation of cytoplasmic TJ and AJ proteins in SEPT9-KO mice. (N-P) Measurements of junctional morphology in colonic mucosa of SEPT9-KO and control mice examined via measuring circularity (N), solidity (O), and the cell surface area (P); n= 5/group. Data represented as box-whisker plots with whiskers extending to the minimum and the maximum and mean at the middle of the box body. **p<0.01, ****p<0.0001.

Article Snippet: DLD-1 cells were grown to sub-confluency and transfected with human SEPT9-GFP plasmid (OriGene, Rockville, MD; RG225682).

Techniques: Western Blot, Expressing, Immunolabeling, Control, Whisker Assay

(A) Full thickness sections of the distal colonic segments stained with H&E. (B and C) En face imaging of colonic epithelium labeled with F-actin probe, Alexa Fluor-tagged phalloidin (6 area/mouse, n= 6 mice/group). Representative images (B) and quantification of Goblet cell numbers (dark holes in the F-actin labeling) are shown (C). Data is shown as box whisker plots with whiskers extending to the minimum and the maximum with mean value at the middle of the box body. Student’s t-test. **p<0.01. Scale bar = 25μm (D) Dual fluorescence labeling of MUC2 and F-actin in colonic tissues of control and SEPT9-KO mice Scale bar = 10μm.

Journal: bioRxiv

Article Title: The Septin Cytoskeleton is a Novel Regulator of Intestinal Epithelial Barrier Integrity and Mucosal Inflammation

doi: 10.1101/2024.12.20.629767

Figure Lengend Snippet: (A) Full thickness sections of the distal colonic segments stained with H&E. (B and C) En face imaging of colonic epithelium labeled with F-actin probe, Alexa Fluor-tagged phalloidin (6 area/mouse, n= 6 mice/group). Representative images (B) and quantification of Goblet cell numbers (dark holes in the F-actin labeling) are shown (C). Data is shown as box whisker plots with whiskers extending to the minimum and the maximum with mean value at the middle of the box body. Student’s t-test. **p<0.01. Scale bar = 25μm (D) Dual fluorescence labeling of MUC2 and F-actin in colonic tissues of control and SEPT9-KO mice Scale bar = 10μm.

Article Snippet: DLD-1 cells were grown to sub-confluency and transfected with human SEPT9-GFP plasmid (OriGene, Rockville, MD; RG225682).

Techniques: Staining, Imaging, Labeling, Whisker Assay, Fluorescence, Control

B ) Representative images of en face intestinal epithelial segmentation in entire and detailed images. (A1) Representative image of junctional protein quantification. 0.6µm of wholemount colon tissue labeled with ZO-1 antibody was employed as an example (A2) Binary mask of cells generated from the original image with additional manual filtration. (A3) Overlay of the original image (green) with the binary mask (red). (A4) Binary mask of the junctions highlighting the intercellular borders. (A5) Overlay of the original image (green) with the junctional mask (red) in yellow. (B1) Representative image of junctional protein quantification. 0.6µm of wholemount colon tissue labeled with ZO-1 antibody was employed as an example (B2) Binary mask of the cell created from the original image. (B3) Binary mask of the junction of the cell of interest. (B4) Overlay of the original image (green) with the binary mask of the cell (red) and the binary mask of the junction (blue). (B5) Marked area (yellow ring) where junctional FI was measured using ImageJ. ( C and D ) Immunoblotting analysis of junctional protein expression in in colonic scrapes obtained from control SEPT9 Flox and SEPT9 cKO mice. Representative immunoblots (C) and densitometric quantification of protein expression (D) are shown (n= 4/group). The intensities of the bands for each sample were normalized to those for GAPDH, and the intensity of the bands in the controlled group was assigned a value of 1. Data are shown as mean ± SEM. * p<0.05.

Journal: bioRxiv

Article Title: The Septin Cytoskeleton is a Novel Regulator of Intestinal Epithelial Barrier Integrity and Mucosal Inflammation

doi: 10.1101/2024.12.20.629767

Figure Lengend Snippet: B ) Representative images of en face intestinal epithelial segmentation in entire and detailed images. (A1) Representative image of junctional protein quantification. 0.6µm of wholemount colon tissue labeled with ZO-1 antibody was employed as an example (A2) Binary mask of cells generated from the original image with additional manual filtration. (A3) Overlay of the original image (green) with the binary mask (red). (A4) Binary mask of the junctions highlighting the intercellular borders. (A5) Overlay of the original image (green) with the junctional mask (red) in yellow. (B1) Representative image of junctional protein quantification. 0.6µm of wholemount colon tissue labeled with ZO-1 antibody was employed as an example (B2) Binary mask of the cell created from the original image. (B3) Binary mask of the junction of the cell of interest. (B4) Overlay of the original image (green) with the binary mask of the cell (red) and the binary mask of the junction (blue). (B5) Marked area (yellow ring) where junctional FI was measured using ImageJ. ( C and D ) Immunoblotting analysis of junctional protein expression in in colonic scrapes obtained from control SEPT9 Flox and SEPT9 cKO mice. Representative immunoblots (C) and densitometric quantification of protein expression (D) are shown (n= 4/group). The intensities of the bands for each sample were normalized to those for GAPDH, and the intensity of the bands in the controlled group was assigned a value of 1. Data are shown as mean ± SEM. * p<0.05.

Article Snippet: DLD-1 cells were grown to sub-confluency and transfected with human SEPT9-GFP plasmid (OriGene, Rockville, MD; RG225682).

Techniques: Labeling, Generated, Filtration, Western Blot, Expressing, Control

(A) Immunoblotting analysis of SEPT9 expression in HT-29 cells with CRISPR/Cas9 mediated knockout of SEPT9 using two different sgRNAs. (B) Transepithelial electrical resistance (TEER) of control and SEPT9-KO HT-29 cells. (C) FITC-dextran flux in control and SEPT9-KO HT-29 cells. Mean ± SEM, n= 4; (D-K) Representative images and quantification of immunolabeled junctional markers in control and SEPT9-KO HT-29 cells, including claudin3 (D and E), ZO-1 (F and G), β-catenin (H and I), and E-cadherin (J and K). Scale bar= 10 μm. Data represented as box-whisker plots with whiskers extending to the minimum and the maximum and mean at the middle of the box body. **p<0.01, ****p<0.0001.

Journal: bioRxiv

Article Title: The Septin Cytoskeleton is a Novel Regulator of Intestinal Epithelial Barrier Integrity and Mucosal Inflammation

doi: 10.1101/2024.12.20.629767

Figure Lengend Snippet: (A) Immunoblotting analysis of SEPT9 expression in HT-29 cells with CRISPR/Cas9 mediated knockout of SEPT9 using two different sgRNAs. (B) Transepithelial electrical resistance (TEER) of control and SEPT9-KO HT-29 cells. (C) FITC-dextran flux in control and SEPT9-KO HT-29 cells. Mean ± SEM, n= 4; (D-K) Representative images and quantification of immunolabeled junctional markers in control and SEPT9-KO HT-29 cells, including claudin3 (D and E), ZO-1 (F and G), β-catenin (H and I), and E-cadherin (J and K). Scale bar= 10 μm. Data represented as box-whisker plots with whiskers extending to the minimum and the maximum and mean at the middle of the box body. **p<0.01, ****p<0.0001.

Article Snippet: DLD-1 cells were grown to sub-confluency and transfected with human SEPT9-GFP plasmid (OriGene, Rockville, MD; RG225682).

Techniques: Western Blot, Expressing, CRISPR, Knock-Out, Control, Immunolabeling, Whisker Assay

(A) Immunoblotting analysis of junctional protein and myosin motor expression in control and SEPT9-KO HT-29 cells. Levels normalized to relative expression of GAPDH are shown in the boxes. (B) MTT assay and (C) cell number counting of control, and SEPT9-KO (sg4: brown; sg6: orange) HT-29 cells at different times after plating. Data shown as mean ± SEM (n =3).

Journal: bioRxiv

Article Title: The Septin Cytoskeleton is a Novel Regulator of Intestinal Epithelial Barrier Integrity and Mucosal Inflammation

doi: 10.1101/2024.12.20.629767

Figure Lengend Snippet: (A) Immunoblotting analysis of junctional protein and myosin motor expression in control and SEPT9-KO HT-29 cells. Levels normalized to relative expression of GAPDH are shown in the boxes. (B) MTT assay and (C) cell number counting of control, and SEPT9-KO (sg4: brown; sg6: orange) HT-29 cells at different times after plating. Data shown as mean ± SEM (n =3).

Article Snippet: DLD-1 cells were grown to sub-confluency and transfected with human SEPT9-GFP plasmid (OriGene, Rockville, MD; RG225682).

Techniques: Western Blot, Expressing, Control, MTT Assay

(A) Interactome analysis of the binding partners for SEPT9 in IECs in vitro . (B) Co-transfection of SEPT9 (green) and NMIIC (red) in COS-7 cell line. The white boxes indicated the zoomed area (Merged). Scale bar= 2 μm

Journal: bioRxiv

Article Title: The Septin Cytoskeleton is a Novel Regulator of Intestinal Epithelial Barrier Integrity and Mucosal Inflammation

doi: 10.1101/2024.12.20.629767

Figure Lengend Snippet: (A) Interactome analysis of the binding partners for SEPT9 in IECs in vitro . (B) Co-transfection of SEPT9 (green) and NMIIC (red) in COS-7 cell line. The white boxes indicated the zoomed area (Merged). Scale bar= 2 μm

Article Snippet: DLD-1 cells were grown to sub-confluency and transfected with human SEPT9-GFP plasmid (OriGene, Rockville, MD; RG225682).

Techniques: Binding Assay, In Vitro, Cotransfection

(A) Super-resolution microscopy image of SEPT9 (green) and NMIIC (magenta) in DLD-1 human colonic epithelial cells. (B) Fluorescence intensities profiles show SEPT9 and NMIIC signal intercalation along the cell-cell junction highlighted by the white arrow. (C and D) Representative image and junction to cytoplasmic ratio of immunolabeled NMIIC in colonic mucosa of SEPT9-KO and control mice, (E and F) Representative image and junction to cytoplasmic ratio of immunolabeled NMIIC in control and SEPT9-KO HT-29 cells. Data presented as box-whisker plots with n= 5/group. **p<0.01, ****p<0.0001; Scale bars= 10 μm. ( G ) Immunoblotting analysis of NMIIC expression in Caco-2 cells with CRISPR/Cas9-mediated knockout of NMIIC. ( H ) TEER of control and NMIIC-KO cells. ( I ) FITC-dextran flux in control and NMIIC-KO Caco-2 cells. Mean ± SEM, n= 4; **p<0.01, **** p<0.001.

Journal: bioRxiv

Article Title: The Septin Cytoskeleton is a Novel Regulator of Intestinal Epithelial Barrier Integrity and Mucosal Inflammation

doi: 10.1101/2024.12.20.629767

Figure Lengend Snippet: (A) Super-resolution microscopy image of SEPT9 (green) and NMIIC (magenta) in DLD-1 human colonic epithelial cells. (B) Fluorescence intensities profiles show SEPT9 and NMIIC signal intercalation along the cell-cell junction highlighted by the white arrow. (C and D) Representative image and junction to cytoplasmic ratio of immunolabeled NMIIC in colonic mucosa of SEPT9-KO and control mice, (E and F) Representative image and junction to cytoplasmic ratio of immunolabeled NMIIC in control and SEPT9-KO HT-29 cells. Data presented as box-whisker plots with n= 5/group. **p<0.01, ****p<0.0001; Scale bars= 10 μm. ( G ) Immunoblotting analysis of NMIIC expression in Caco-2 cells with CRISPR/Cas9-mediated knockout of NMIIC. ( H ) TEER of control and NMIIC-KO cells. ( I ) FITC-dextran flux in control and NMIIC-KO Caco-2 cells. Mean ± SEM, n= 4; **p<0.01, **** p<0.001.

Article Snippet: DLD-1 cells were grown to sub-confluency and transfected with human SEPT9-GFP plasmid (OriGene, Rockville, MD; RG225682).

Techniques: Super-Resolution Microscopy, Fluorescence, Immunolabeling, Control, Whisker Assay, Western Blot, Expressing, CRISPR, Knock-Out

( A ) Principal Component Analysis (PCA) of gene expression profiles in colonic and ileal epithelial cells isolated from SEPT9-KO and control mice. Volcano plots comparing gene expression in ( B ) colonic and ( C ) ileal epithelium of SEPT9-KO and control mice. Significant differentially (p-value and log2FC cut-off) expressed genes are highlighted. Bubble plots representing pathway enrichment analysis of genes with statistically significant differences in expression between the SEPT9-KO and control mice in the ( D ) colonic and ( E ) ileal epithelium. Each bubble corresponds to a specific pathway, with size indicating the gene ratio and color representing the significance of the enrichment. The analysis was performed using isolated IEC from 5 mice/group.

Journal: bioRxiv

Article Title: The Septin Cytoskeleton is a Novel Regulator of Intestinal Epithelial Barrier Integrity and Mucosal Inflammation

doi: 10.1101/2024.12.20.629767

Figure Lengend Snippet: ( A ) Principal Component Analysis (PCA) of gene expression profiles in colonic and ileal epithelial cells isolated from SEPT9-KO and control mice. Volcano plots comparing gene expression in ( B ) colonic and ( C ) ileal epithelium of SEPT9-KO and control mice. Significant differentially (p-value and log2FC cut-off) expressed genes are highlighted. Bubble plots representing pathway enrichment analysis of genes with statistically significant differences in expression between the SEPT9-KO and control mice in the ( D ) colonic and ( E ) ileal epithelium. Each bubble corresponds to a specific pathway, with size indicating the gene ratio and color representing the significance of the enrichment. The analysis was performed using isolated IEC from 5 mice/group.

Article Snippet: DLD-1 cells were grown to sub-confluency and transfected with human SEPT9-GFP plasmid (OriGene, Rockville, MD; RG225682).

Techniques: Expressing, Isolation, Control

SEPT9-KO and control mice were exposed to 3% DSS in drinking water, or regular water for 7 days. ( A ) Body weight loss and ( B ) disease activity index, were recorded daily. ( C and D ) Intestinal permeability of DSS-treated SEPT9-KO and control mice. Gut-to-blood passage of 4 kDa FITC-dextran (C) and 70 kDa Rhodamine-dextran (D). ( E ) mRNA expression of inflammatory markers measured in colonic tissues of DSS-treated SEPT9-KO and control mice. (F-K) Immunolabeling and quantification of leukocyte infiltration (red) in the colonic mucosa of SEPT9-KO and control mice on day 7 of DSS or water exposure, including T-cells (F and G), monocytes/macrophages (H and I) and neutrophils (J and K), as well as TUNEL labeling of apoptotic cells (L and M). Nuclei are labeled with DAPI (blue). Scale bars= 20 μm. Mean ± SEM (n = 6); *p < 0.05, **p<0.01 *** p<0.001, ****p<0.0001. The scatter dots within the bars in C, D , and E represent individual mice. The scatter dots in the G, I, K and M graphs represent pooled cell numbers.

Journal: bioRxiv

Article Title: The Septin Cytoskeleton is a Novel Regulator of Intestinal Epithelial Barrier Integrity and Mucosal Inflammation

doi: 10.1101/2024.12.20.629767

Figure Lengend Snippet: SEPT9-KO and control mice were exposed to 3% DSS in drinking water, or regular water for 7 days. ( A ) Body weight loss and ( B ) disease activity index, were recorded daily. ( C and D ) Intestinal permeability of DSS-treated SEPT9-KO and control mice. Gut-to-blood passage of 4 kDa FITC-dextran (C) and 70 kDa Rhodamine-dextran (D). ( E ) mRNA expression of inflammatory markers measured in colonic tissues of DSS-treated SEPT9-KO and control mice. (F-K) Immunolabeling and quantification of leukocyte infiltration (red) in the colonic mucosa of SEPT9-KO and control mice on day 7 of DSS or water exposure, including T-cells (F and G), monocytes/macrophages (H and I) and neutrophils (J and K), as well as TUNEL labeling of apoptotic cells (L and M). Nuclei are labeled with DAPI (blue). Scale bars= 20 μm. Mean ± SEM (n = 6); *p < 0.05, **p<0.01 *** p<0.001, ****p<0.0001. The scatter dots within the bars in C, D , and E represent individual mice. The scatter dots in the G, I, K and M graphs represent pooled cell numbers.

Article Snippet: DLD-1 cells were grown to sub-confluency and transfected with human SEPT9-GFP plasmid (OriGene, Rockville, MD; RG225682).

Techniques: Control, Activity Assay, Permeability, Expressing, Immunolabeling, TUNEL Assay, Labeling

Mucosal injury and inflammation were examined in H&E-stained distal colonic sections of Control and SEPT9-KO mice on day 7 of DSS treatment. (A) Representative H&E images and (B) calculated tissue injury index are shown as mean ± SEM. (n= 5 in water-treated groups and n= 7 in DSS-treated groups)

Journal: bioRxiv

Article Title: The Septin Cytoskeleton is a Novel Regulator of Intestinal Epithelial Barrier Integrity and Mucosal Inflammation

doi: 10.1101/2024.12.20.629767

Figure Lengend Snippet: Mucosal injury and inflammation were examined in H&E-stained distal colonic sections of Control and SEPT9-KO mice on day 7 of DSS treatment. (A) Representative H&E images and (B) calculated tissue injury index are shown as mean ± SEM. (n= 5 in water-treated groups and n= 7 in DSS-treated groups)

Article Snippet: DLD-1 cells were grown to sub-confluency and transfected with human SEPT9-GFP plasmid (OriGene, Rockville, MD; RG225682).

Techniques: Staining, Control

(A) Immunofluorescence labeling of SEPT9 (green) and E-cadherin (red) in cryosections of ileal and colonic tissue from IBD patients and non-IBD controls. Arrows point to SEPT9 localization at epithelial junctions in normal sample. Arrowheads indicate mislocalized and decreased SEPT9 labeling in CD and UC tissue samples. Scale bar= 50 μm ( B and C ) Quantification of the junction to cytoplasmic ratio of SEPT9 signal (B) and total SEPT9 signal intensity (C). Mean ± SEM (n= 6 for normal controls and CD patients, and 5 for UC patients). (D) Immunohistochemistry of SEPT9 labeling in paraffin sections of colonic tissue sections from control and IBD patients. (E) Quantification of total SEPT9 signal intensity. Mean ± SEM (n= 9 for normal controls, 5 for CD and 6 for UC patients). *p<0.05, **p<0.01, ***p<0.001

Journal: bioRxiv

Article Title: The Septin Cytoskeleton is a Novel Regulator of Intestinal Epithelial Barrier Integrity and Mucosal Inflammation

doi: 10.1101/2024.12.20.629767

Figure Lengend Snippet: (A) Immunofluorescence labeling of SEPT9 (green) and E-cadherin (red) in cryosections of ileal and colonic tissue from IBD patients and non-IBD controls. Arrows point to SEPT9 localization at epithelial junctions in normal sample. Arrowheads indicate mislocalized and decreased SEPT9 labeling in CD and UC tissue samples. Scale bar= 50 μm ( B and C ) Quantification of the junction to cytoplasmic ratio of SEPT9 signal (B) and total SEPT9 signal intensity (C). Mean ± SEM (n= 6 for normal controls and CD patients, and 5 for UC patients). (D) Immunohistochemistry of SEPT9 labeling in paraffin sections of colonic tissue sections from control and IBD patients. (E) Quantification of total SEPT9 signal intensity. Mean ± SEM (n= 9 for normal controls, 5 for CD and 6 for UC patients). *p<0.05, **p<0.01, ***p<0.001

Article Snippet: DLD-1 cells were grown to sub-confluency and transfected with human SEPT9-GFP plasmid (OriGene, Rockville, MD; RG225682).

Techniques: Immunofluorescence, Labeling, Immunohistochemistry, Control

Differential peripheral myelin proteome analysis in the Prnp0/0model of chronic demyelinating polyneuropathy. A, 2D-DIGE of wild-type (WT, false-colored in blue) and Prnp0/0 (false colored in orange) myelin. 2D-IEF/SDS-PAGE was performed with IEF in a nonlinear pH gradient (3–11) as the first and SDS-PAGE as the second dimension. Most protein signals appear as black spots, indicating that the overall protein profile is largely similar between the genotypes. One spot at ∼40 kDa was of increased abundance in Prnp0/0 myelin and identified as SEPT9. The corresponding region of a representative gel (red frame) is shown to the right with separated detection channels. Note that the abundance of SEPT9 in wild-type myelin was below the threshold of MS detection. Note also the high comparability with the reference map in Figure 2A. B, Comparison of SEPT9 abundance in myelin of WT and Prnp0/0 myelin by immunoblotting. Note that the abundance of the related SEPT7 was unchanged. Quantification of SEPT9 abundance was relative to that of GAPDH. C, Immunoblot analysis of SEPT9 in brain lysates and myelin-enriched fractions. Note that the abundance of SEPT9 was reduced with myelin purification, different from known constituents of the compact subcompartment of myelin. D, In situ hybridization of Sept9 in sciatic nerves. Note that Schwann cells are strongly labeled. Scale bar, 6 μm. E, Quantitative RT-PCR analysis of Sept9 in adult wild-type and Prnp0/0 sciatic nerves. Sept9-mRNA abundance was unaltered. F, Immunodetection of SEPT9 visualized with 10 nm gold particles in wild-type sciatic nerve cross sections. SEPT9 labeling was confined to the abaxonal noncompact subcompartment of myelin (bands of Cajal). The magnification shows that SEPT9 was associated with membranous structures, most likely intracellular transport vesicles (F′, arrowheads). G, No labeling was found in wild-type Schmidt–Lanterman incisures. H, SEPT9 was readily detected in Schmidt–Lanterman incisures of Prnp0/0 myelin (arrowheads). Scale bars: F, 500 nm; and G, H, 200 nm.

Journal: The Journal of Neuroscience

Article Title: Quantitative and Integrative Proteome Analysis of Peripheral Nerve Myelin Identifies Novel Myelin Proteins and Candidate Neuropathy Loci

doi: 10.1523/JNEUROSCI.4016-11.2011

Figure Lengend Snippet: Differential peripheral myelin proteome analysis in the Prnp0/0model of chronic demyelinating polyneuropathy. A, 2D-DIGE of wild-type (WT, false-colored in blue) and Prnp0/0 (false colored in orange) myelin. 2D-IEF/SDS-PAGE was performed with IEF in a nonlinear pH gradient (3–11) as the first and SDS-PAGE as the second dimension. Most protein signals appear as black spots, indicating that the overall protein profile is largely similar between the genotypes. One spot at ∼40 kDa was of increased abundance in Prnp0/0 myelin and identified as SEPT9. The corresponding region of a representative gel (red frame) is shown to the right with separated detection channels. Note that the abundance of SEPT9 in wild-type myelin was below the threshold of MS detection. Note also the high comparability with the reference map in Figure 2A. B, Comparison of SEPT9 abundance in myelin of WT and Prnp0/0 myelin by immunoblotting. Note that the abundance of the related SEPT7 was unchanged. Quantification of SEPT9 abundance was relative to that of GAPDH. C, Immunoblot analysis of SEPT9 in brain lysates and myelin-enriched fractions. Note that the abundance of SEPT9 was reduced with myelin purification, different from known constituents of the compact subcompartment of myelin. D, In situ hybridization of Sept9 in sciatic nerves. Note that Schwann cells are strongly labeled. Scale bar, 6 μm. E, Quantitative RT-PCR analysis of Sept9 in adult wild-type and Prnp0/0 sciatic nerves. Sept9-mRNA abundance was unaltered. F, Immunodetection of SEPT9 visualized with 10 nm gold particles in wild-type sciatic nerve cross sections. SEPT9 labeling was confined to the abaxonal noncompact subcompartment of myelin (bands of Cajal). The magnification shows that SEPT9 was associated with membranous structures, most likely intracellular transport vesicles (F′, arrowheads). G, No labeling was found in wild-type Schmidt–Lanterman incisures. H, SEPT9 was readily detected in Schmidt–Lanterman incisures of Prnp0/0 myelin (arrowheads). Scale bars: F, 500 nm; and G, H, 200 nm.

Article Snippet: Antibodies were specific for PLP/DM20 ( Jung et al., 1996 ), plasmolipin ( Bosse et al., 2003 ), myelin and lymphocyte protein (MAL) ( Schaeren-Wiemers et al., 2004 ), PMP22 (ab15506, Abcam), CD9 (PharMingen), CD81 (PharMingen), CMTM5 (CKLF-like MARVEL-transmembrane domain-containing protein 5, also termed PETA-3; ab88964, Abcam; or M-13, Santa Cruz Biotechnology, yielding similar results), CD151 [455807, R&D Systems ( Cowin et al., 2006 )], septin 9 (SEPT9) [10769, Protein Tech Group and Nagata et al., (2004 ) (yielding similar results)], MAG (clone 513, Millipore Bioscience Research Reagents), 2′,3′-cyclic nucleotide phosphodiesterase (CNP; 11–5B, Sigma), COX4 (MS404, MitoSciences), and actin (Mab1501, Millipore Bioscience Research Reagents).

Techniques: SDS Page, Western Blot, Purification, In Situ Hybridization, Labeling, Quantitative RT-PCR, Immunodetection

Comparison of neuropathy disease loci and proteins identified in PNS myelin

Journal: The Journal of Neuroscience

Article Title: Quantitative and Integrative Proteome Analysis of Peripheral Nerve Myelin Identifies Novel Myelin Proteins and Candidate Neuropathy Loci

doi: 10.1523/JNEUROSCI.4016-11.2011

Figure Lengend Snippet: Comparison of neuropathy disease loci and proteins identified in PNS myelin

Article Snippet: Antibodies were specific for PLP/DM20 ( Jung et al., 1996 ), plasmolipin ( Bosse et al., 2003 ), myelin and lymphocyte protein (MAL) ( Schaeren-Wiemers et al., 2004 ), PMP22 (ab15506, Abcam), CD9 (PharMingen), CD81 (PharMingen), CMTM5 (CKLF-like MARVEL-transmembrane domain-containing protein 5, also termed PETA-3; ab88964, Abcam; or M-13, Santa Cruz Biotechnology, yielding similar results), CD151 [455807, R&D Systems ( Cowin et al., 2006 )], septin 9 (SEPT9) [10769, Protein Tech Group and Nagata et al., (2004 ) (yielding similar results)], MAG (clone 513, Millipore Bioscience Research Reagents), 2′,3′-cyclic nucleotide phosphodiesterase (CNP; 11–5B, Sigma), COX4 (MS404, MitoSciences), and actin (Mab1501, Millipore Bioscience Research Reagents).

Techniques:

Mass-spectrometrically identified myelin proteins additionally validated with immuno-based methods

Journal: The Journal of Neuroscience

Article Title: Quantitative and Integrative Proteome Analysis of Peripheral Nerve Myelin Identifies Novel Myelin Proteins and Candidate Neuropathy Loci

doi: 10.1523/JNEUROSCI.4016-11.2011

Figure Lengend Snippet: Mass-spectrometrically identified myelin proteins additionally validated with immuno-based methods

Article Snippet: Antibodies were specific for PLP/DM20 ( Jung et al., 1996 ), plasmolipin ( Bosse et al., 2003 ), myelin and lymphocyte protein (MAL) ( Schaeren-Wiemers et al., 2004 ), PMP22 (ab15506, Abcam), CD9 (PharMingen), CD81 (PharMingen), CMTM5 (CKLF-like MARVEL-transmembrane domain-containing protein 5, also termed PETA-3; ab88964, Abcam; or M-13, Santa Cruz Biotechnology, yielding similar results), CD151 [455807, R&D Systems ( Cowin et al., 2006 )], septin 9 (SEPT9) [10769, Protein Tech Group and Nagata et al., (2004 ) (yielding similar results)], MAG (clone 513, Millipore Bioscience Research Reagents), 2′,3′-cyclic nucleotide phosphodiesterase (CNP; 11–5B, Sigma), COX4 (MS404, MitoSciences), and actin (Mab1501, Millipore Bioscience Research Reagents).

Techniques: Histone Deacetylase Assay

Glucose-sensitive clonal INS-1 832/13 β-cells were used to study the impact of Cdkn1a, Pde7b, Sept9 and Exoc3l on insulin secretion and β-cell function. ( A ) Overexpression of Cdkn1a , Pde7b and Sept9 with pcDNA3.1 expression vectors in clonal β-cells resulted in elevated mRNA levels (black bars) compared with β-cells transfected with an empty pcDNA3.1 vector (white bars). * P <0.05. Data are mean ± SEM. Overexpression was also evident at the protein level as determined by immunoblot detection of the HA-tag situated on the c-terminal of the cloned cDNAs (rightmost panel) ( B ) Insulin secretion in response to 2.8 mM (white bars) and 16.7 mM (black bars) glucose in clonal β-cells overexpressing either Cdkn1a, Pde7b or Sept9 compared with control cells transfected with an empty pcDNA3.1 vector (n = 5). * P <0.05. Data are mean ± SEM ( C ) Decreased cell proliferation in clonal β-cells overexpressing Cdkn1a (black bar) compared with cells transfected with an empty pcDNA3.1 vector (white bar) (n = 4). * P <0.05. Data are mean ± SEM ( D ) Insulin secretion in response to 2.8 mM and 16.7 mM glucose (Gluc) or 16.7 mM glucose (Gluc) in combination with 100 µM IBMX in clonal β-cells overexpressing Pde7b (black bars) compared with cells transfected with an empty pcDNA3.1 vector (white bars) (n = 3). * P <0.05. NS = not significant. ( E ) Increased DNA methylation and decreased mRNA expression of EXOC3L2 in pancreatic islets of 15 T2D versus 34 non-diabetic donors. ( F ) Transfection of clonal β-cells with siRNA targeting Exoc3l resulted in decreased Exoc3l mRNA expression (siExo3l, black bar) when compared with clonal β-cells transfected with negative control siRNA (siNC, white bar) (n = 3). * P <0.05. Silencing of Exoc3l resulted in decreased Ca 2+ -dependent exocytosis; ( G ) Depolarizationevoked a decrease in membrane capacitance (ΔC m ) in single INS1-832/13 β-cells where Exoc3l was silenced (black trace) compared with control β-cells (grey trace) treated with negative control siRNA. ( H ) Histogram of the summed increase in membrane capacitance evoked by the two first depolarizations (Σ 1–2 ), the latter eight depolarizations (Σ 3–10 ) or all depolarizations in the train (Σ all ). Data are mean ± SEM of n = 11 β-cells treated with control siRNA (white bars) and n = 4 β-cells treated with siRNA against Exoc3l (black bars). * P <0.05. ( I ) Depolarization-evoked increase in current (I) in single INS1-832/13 β-cells treated with control siRNA (grey trace) or siRNA targeting Exoc3l (black trace). Notice that the rapid Na + -current is markedly diminished in siExoc3l treated clonal β-cells. ( J ) Reduced expression of Exoc3l has no effect on the Ca 2+ influx. Charge (Q)-voltage (V m ) relationship in β-cells treated with control (white squares) siRNA and siRNA against Exoc3l (black circles). The charge is representative of the Ca 2+ -influx into the cell through the voltage-dependent Ca 2+ channels. ( K ) As in J , but the peak-current (Ipeak)-voltage (Vm)-relationship was estimated as a representation of the voltage-dependent Na + current. The Na + current is significantly reduced in siExoc3l cells ( P <0.05) versus control siRNA cells except for the depolarization to −40 mV. Data in J and K are mean ± SEM of n = 11 β-cells treated with control siRNA and n = 7 siExoc3l treated β-cells. ( L ) αTC1-6 cells were used to determine the impact of Cdkn1a, Pde7b and Sept9 on glucagon secretion. Overexpression of Cdkn1a and Pde7b resulted in significantly increased glucagon secretion at 1 mM glucose (white bars) (n = 4, * P <0.05), while overexpression of Pde7b and Sept9 resulted in increased glucagon secretion at 16.7 mM glucose (black bars) (n = 4, ¤ P <0.05) compared with control cells transfected with an empty pcDNA3.1 vector.

Journal: PLoS Genetics

Article Title: Genome-Wide DNA Methylation Analysis of Human Pancreatic Islets from Type 2 Diabetic and Non-Diabetic Donors Identifies Candidate Genes That Influence Insulin Secretion

doi: 10.1371/journal.pgen.1004160

Figure Lengend Snippet: Glucose-sensitive clonal INS-1 832/13 β-cells were used to study the impact of Cdkn1a, Pde7b, Sept9 and Exoc3l on insulin secretion and β-cell function. ( A ) Overexpression of Cdkn1a , Pde7b and Sept9 with pcDNA3.1 expression vectors in clonal β-cells resulted in elevated mRNA levels (black bars) compared with β-cells transfected with an empty pcDNA3.1 vector (white bars). * P <0.05. Data are mean ± SEM. Overexpression was also evident at the protein level as determined by immunoblot detection of the HA-tag situated on the c-terminal of the cloned cDNAs (rightmost panel) ( B ) Insulin secretion in response to 2.8 mM (white bars) and 16.7 mM (black bars) glucose in clonal β-cells overexpressing either Cdkn1a, Pde7b or Sept9 compared with control cells transfected with an empty pcDNA3.1 vector (n = 5). * P <0.05. Data are mean ± SEM ( C ) Decreased cell proliferation in clonal β-cells overexpressing Cdkn1a (black bar) compared with cells transfected with an empty pcDNA3.1 vector (white bar) (n = 4). * P <0.05. Data are mean ± SEM ( D ) Insulin secretion in response to 2.8 mM and 16.7 mM glucose (Gluc) or 16.7 mM glucose (Gluc) in combination with 100 µM IBMX in clonal β-cells overexpressing Pde7b (black bars) compared with cells transfected with an empty pcDNA3.1 vector (white bars) (n = 3). * P <0.05. NS = not significant. ( E ) Increased DNA methylation and decreased mRNA expression of EXOC3L2 in pancreatic islets of 15 T2D versus 34 non-diabetic donors. ( F ) Transfection of clonal β-cells with siRNA targeting Exoc3l resulted in decreased Exoc3l mRNA expression (siExo3l, black bar) when compared with clonal β-cells transfected with negative control siRNA (siNC, white bar) (n = 3). * P <0.05. Silencing of Exoc3l resulted in decreased Ca 2+ -dependent exocytosis; ( G ) Depolarizationevoked a decrease in membrane capacitance (ΔC m ) in single INS1-832/13 β-cells where Exoc3l was silenced (black trace) compared with control β-cells (grey trace) treated with negative control siRNA. ( H ) Histogram of the summed increase in membrane capacitance evoked by the two first depolarizations (Σ 1–2 ), the latter eight depolarizations (Σ 3–10 ) or all depolarizations in the train (Σ all ). Data are mean ± SEM of n = 11 β-cells treated with control siRNA (white bars) and n = 4 β-cells treated with siRNA against Exoc3l (black bars). * P <0.05. ( I ) Depolarization-evoked increase in current (I) in single INS1-832/13 β-cells treated with control siRNA (grey trace) or siRNA targeting Exoc3l (black trace). Notice that the rapid Na + -current is markedly diminished in siExoc3l treated clonal β-cells. ( J ) Reduced expression of Exoc3l has no effect on the Ca 2+ influx. Charge (Q)-voltage (V m ) relationship in β-cells treated with control (white squares) siRNA and siRNA against Exoc3l (black circles). The charge is representative of the Ca 2+ -influx into the cell through the voltage-dependent Ca 2+ channels. ( K ) As in J , but the peak-current (Ipeak)-voltage (Vm)-relationship was estimated as a representation of the voltage-dependent Na + current. The Na + current is significantly reduced in siExoc3l cells ( P <0.05) versus control siRNA cells except for the depolarization to −40 mV. Data in J and K are mean ± SEM of n = 11 β-cells treated with control siRNA and n = 7 siExoc3l treated β-cells. ( L ) αTC1-6 cells were used to determine the impact of Cdkn1a, Pde7b and Sept9 on glucagon secretion. Overexpression of Cdkn1a and Pde7b resulted in significantly increased glucagon secretion at 1 mM glucose (white bars) (n = 4, * P <0.05), while overexpression of Pde7b and Sept9 resulted in increased glucagon secretion at 16.7 mM glucose (black bars) (n = 4, ¤ P <0.05) compared with control cells transfected with an empty pcDNA3.1 vector.

Article Snippet: Overexpression was verified with real-time PCR using an ABI 7900 system (Applied Biosystems, Foster City, CA, USA) and a SYBR Green assay for Cdkn1a (fwd-primer: ATGTCCGACCTGTTCCACAC , rev-primer: CAGACGTAGTTGCCCTCCAG ) or TaqMan assays (Life Technologies) for Pde7b (Rn00590117_m1) and Sept9 (Rn00582942_m1).

Techniques: Cell Function Assay, Over Expression, Expressing, Transfection, Plasmid Preparation, Western Blot, Clone Assay, Control, DNA Methylation Assay, Negative Control, Membrane

Technical validation of Infinium HumanMethylation450 BeadChip data using pyrosequencing.

Journal: PLoS Genetics

Article Title: Genome-Wide DNA Methylation Analysis of Human Pancreatic Islets from Type 2 Diabetic and Non-Diabetic Donors Identifies Candidate Genes That Influence Insulin Secretion

doi: 10.1371/journal.pgen.1004160

Figure Lengend Snippet: Technical validation of Infinium HumanMethylation450 BeadChip data using pyrosequencing.

Article Snippet: Overexpression was verified with real-time PCR using an ABI 7900 system (Applied Biosystems, Foster City, CA, USA) and a SYBR Green assay for Cdkn1a (fwd-primer: ATGTCCGACCTGTTCCACAC , rev-primer: CAGACGTAGTTGCCCTCCAG ) or TaqMan assays (Life Technologies) for Pde7b (Rn00590117_m1) and Sept9 (Rn00582942_m1).

Techniques: Biomarker Discovery

DNA methylation of SHOX2 and SEPT9 in ascitic samples from cancer and non-cancer patients. Comparison of SHOX2 and SEPT9 methylation of ascitic DNA from cancer patients and patients with exclusively non-malignant diseases determined by quantitative real-time PCR. Methylation cutoffs were introduced for SHOX2 and SEPT9 to dichotomize patient samples as SHOX2 or SEPT9 positive (above the cutoff) or negative (below the cutoff), respectively. The indicated p values refer to the Mann-Whitney U tests. a DNA methylation analysis of the cellular fractions of ascites samples ( n = 283). b Methylation results of cell-free ascitic DNA ( n = 162)

Journal: Clinical Epigenetics

Article Title: Diagnostic and prognostic value of SHOX2 and SEPT9 DNA methylation and cytology in benign, paramalignant, and malignant ascites

doi: 10.1186/s13148-016-0192-7

Figure Lengend Snippet: DNA methylation of SHOX2 and SEPT9 in ascitic samples from cancer and non-cancer patients. Comparison of SHOX2 and SEPT9 methylation of ascitic DNA from cancer patients and patients with exclusively non-malignant diseases determined by quantitative real-time PCR. Methylation cutoffs were introduced for SHOX2 and SEPT9 to dichotomize patient samples as SHOX2 or SEPT9 positive (above the cutoff) or negative (below the cutoff), respectively. The indicated p values refer to the Mann-Whitney U tests. a DNA methylation analysis of the cellular fractions of ascites samples ( n = 283). b Methylation results of cell-free ascitic DNA ( n = 162)

Article Snippet: Competing interests Dimo Dietrich has been an employee and is a stockholder of Epigenomics AG, a company that aims to commercialize the DNA methylation biomarkers SEPT9 and SHOX2 .

Techniques: DNA Methylation Assay, Comparison, Methylation, Real-time Polymerase Chain Reaction, MANN-WHITNEY

Kaplan-Meier survival analyses of cell-free and cellular DNA methylation analyses and cytology. Kaplan-Meier analysis of overall survival in 283 patients stratified by the cytological diagnosis or the cell-free and cellular DNA methylation status of SHOX2 and SEPT9. The p values refer to the log-rank test. a Results of cellular DNA methylation analysis and cytology. b Results of cell-free DNA methylation analysis and cytology

Journal: Clinical Epigenetics

Article Title: Diagnostic and prognostic value of SHOX2 and SEPT9 DNA methylation and cytology in benign, paramalignant, and malignant ascites

doi: 10.1186/s13148-016-0192-7

Figure Lengend Snippet: Kaplan-Meier survival analyses of cell-free and cellular DNA methylation analyses and cytology. Kaplan-Meier analysis of overall survival in 283 patients stratified by the cytological diagnosis or the cell-free and cellular DNA methylation status of SHOX2 and SEPT9. The p values refer to the log-rank test. a Results of cellular DNA methylation analysis and cytology. b Results of cell-free DNA methylation analysis and cytology

Article Snippet: Competing interests Dimo Dietrich has been an employee and is a stockholder of Epigenomics AG, a company that aims to commercialize the DNA methylation biomarkers SEPT9 and SHOX2 .

Techniques: DNA Methylation Assay, Biomarker Discovery

Clinical performance of the DNA methylation biomarkers  SHOX2  and SEPT9 and cytology in ascites samples

Journal: Clinical Epigenetics

Article Title: Diagnostic and prognostic value of SHOX2 and SEPT9 DNA methylation and cytology in benign, paramalignant, and malignant ascites

doi: 10.1186/s13148-016-0192-7

Figure Lengend Snippet: Clinical performance of the DNA methylation biomarkers SHOX2 and SEPT9 and cytology in ascites samples

Article Snippet: Competing interests Dimo Dietrich has been an employee and is a stockholder of Epigenomics AG, a company that aims to commercialize the DNA methylation biomarkers SEPT9 and SHOX2 .

Techniques: DNA Methylation Assay

Clinical performance of DNA methylation and cytological analyses

Journal: Clinical Epigenetics

Article Title: Diagnostic and prognostic value of SHOX2 and SEPT9 DNA methylation and cytology in benign, paramalignant, and malignant ascites

doi: 10.1186/s13148-016-0192-7

Figure Lengend Snippet: Clinical performance of DNA methylation and cytological analyses

Article Snippet: Competing interests Dimo Dietrich has been an employee and is a stockholder of Epigenomics AG, a company that aims to commercialize the DNA methylation biomarkers SEPT9 and SHOX2 .

Techniques: DNA Methylation Assay, Diagnostic Assay